Chủ Nhật, 20 tháng 4, 2014

Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx


LINK DOWNLOAD MIỄN PHÍ TÀI LIỆU "Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx": http://123doc.vn/document/1050604-tai-lieu-bao-cao-khoa-hoc-his374-of-wheat-endoxylanase-inhibitor-taxi-i-stabilizes-complex-formation-with-glycoside-hydrolase-family-11-endoxylanases-.htm


His374 of wheat endoxylanase inhibitor TAXI-I stabilizes
complex formation with glycoside hydrolase family 11
endoxylanases
Katleen Fierens
1
, Ann Gils
2
, Stefaan Sansen
3
, Kristof Brijs
1
, Christophe M. Courtin
1
,
Paul J. Declerck
2
, Camiel J. De Ranter
3
, Kurt Gebruers
1
, Anja Rabijns
3
, Johan Robben
1
,
Steven Van Campenhout
4
, Guido Volckaert
4
and Jan A. Delcour
1
1 Katholieke Universiteit Leuven, Laboratory of Food Chemistry, Leuven, Belgium
2 Katholieke Universiteit Leuven, Laboratory of Pharmaceutical Biology and Phytopharmacology, Leuven, Belgium
3 Katholieke Universiteit Leuven, Laboratory of Analytical Chemistry and Medicinal Physicochemistry, Leuven, Belgium
4 Katholieke Universiteit Leuven, Laboratory of Gene Technology, Leuven, Belgium
Endoxylanases (EC 3.2.1.8) are key plant or microbial
enzymes in the degradation of arabinoxylan (AX)
[1,2], an important structural and quality determining
nonstarch polysaccharide in cereals. In sequence-based
classifications, endoxylanases are mainly grouped into
glycoside hydrolase families (GH) 10 and 11 (CAZy
database http://afmb.cnrs-mrs.fr/CAZY/) [3]. The cata-
lytic domain of GH11 endoxylanases has a b-jelly roll
fold which resembles the shape of a partially closed
right hand with ‘finger’, ‘palm’ and ‘thumb’ regions
Keywords
endoxylanase; inhibitor; protein–protein
interaction; surface plasmon resonance;
TAXI
Correspondence
K. Fierens, Katholieke Universiteit Leuven,
Laboratory of Food Chemistry, Kasteelpark
Arenberg 20, B-3001 Leuven, Belgium
Fax: +32 16 321997
Tel: +32 16 321634
E-mail: katleen.fierens@biw.kuleuven.be
(Received 24 June 2005, revised 2
September 2005, accepted 22
September 2005)
doi:10.1111/j.1742-4658.2005.04987.x
Wheat endoxylanase inhibitor TAXI-I inhibits microbial glycoside hydro-
lase family 11 endoxylanases. Crystallographic data of an Aspergillus niger
endoxylanase-TAXI-I complex showed His374 of TAXI-I to be a key resi-
due in endoxylanase inhibition [Sansen S, De Ranter CJ, Gebruers K, Brijs
K, Courtin CM, Delcour JA & Rabijns A (2004) J Biol Chem 279, 36022–
36028]. Its role in enzyme–inhibitor interaction was further investigated by
site-directed mutagenesis of His374 into alanine, glutamine or lysine. Bind-
ing kinetics and affinities of the molecular interactions between A. niger,
Bacillus subtilis, Trichoderma longibrachiatum endoxylanases and wild-type
TAXI-I and TAXI-I His374 mutants were determined by surface plasmon
resonance analysis. Enzyme–inhibitor binding was in accordance with a
simple 1 : 1 binding model. Association and dissociation rate constants of
wild-type TAXI-I towards the endoxylanases were in the range between
1.96 and 36.1 · 10
4
m
)1
Æs
)1
and 0.72–3.60 · 10
)4
Æs
)1
, respectively, resulting
in equilibrium dissociation constants in the low nanomolar range. Muta-
tion of TAXI-I His374 to a variable degree reduced the inhibition capacity
of the inhibitor mainly due to higher complex dissociation rate constants
(three- to 80-fold increase). The association rate constants were affected to
a smaller extent (up to eightfold decrease). Substitution of TAXI-I His374
therefore strongly affects the affinity of the inhibitor for the enzymes. In
addition, the results show that His374 plays a critical role in the stabiliza-
tion of the endoxylanase–TAXI-I complex rather than in the docking of
inhibitor onto enzyme.
Abbreviations
AU, absorbance units; GH, glycoside hydrolase family; IU, inhibition units; RU, resonance units; SPR, surface plasmon resonance; TAXI,
Triticum aestivum xylanase inhibitor.
5872 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS
[4]. Its active site is located into the extended open
cleft formed by the ‘palm’ region. GH10 endoxylanases,
comprising all endogenous plant endoxylanases
known to date [5], have the typical (b ⁄ a)
8
barrel fold
[6]. The active site of both endoxylanase families con-
tains two conserved Glu residues that are involved in
substrate hydrolysis via a double displacement mech-
anism [7,8].
Microbial endoxylanases belonging to both GH10
and GH11 are often used to impact AX functionality
in cereal-based biotechnological applications to opti-
mize process parameters, yields and product quality
[9–11]. The presence of cereal endoxylanase inhibitors,
however, impacts the activity of the added endoxylan-
ases. Two structurally different types of proteinaceous
endoxylanase inhibitors have been identified in wheat,
i.e. the TAXI- (Triticum aestivum xylanase inhibitor)
[12,13] and XIP- (Xylanase inhibiting protein) [13,14]
type inhibitors. Two TAXI-type endoxylanase inhibi-
tors have been described, TAXI-I and TAXI-II, both
with molecular mass of 40 kDa but differing from one
another in pI (8.8 and 9.3, respectively) and endoxyla-
nase specificity [15]. Despite very low sequence homol-
ogy levels ( 15% identity), TAXI-I is structurally
homologous with the pepsin-like family of aspartic
proteases [16]. It folds as a two b-barrel domain pro-
tein with a few helical segments, and the separate
domains are divided by an extended cleft. XIP-I, on
the other hand, is a glycosylated, monomeric inhibitor
with a molecular mass of 29 kDa and a basic pI (8.7–
8.9) [14,17]. The inhibitor possesses a (b ⁄ a)
8
barrel
fold and displays structural features typical for GH18
chitinases, but lacks chitinase activity [18]. Sequence
data and 3D structures of TAXI-I and XIP-I show no
structural homology between both types of inhibitors
[16,18–20]. Moreover, these inhibitors have different
endoxylanase specificities. XIP-I inhibits microbial
endoxylanases from GH10 as well as GH11 [21], while
TAXI-I and TAXI-II only inhibit microbial endoxy-
lanases belonging to GH11 [15]. Experimentally deter-
mined K
i
values ranging from 5 to 30 nm for TAXI
[12,22,23] and from 3 to 610 nm for XIP [21] suggest
tight binding inhibition for both inhibitor types.
The 3D structure of TAXI-I complexed with a
GH11 Aspergillus niger endoxylanase revealed both a
direct interaction of the inhibitor with the active site
region of the enzyme as well as substrate-mimicking
contacts filling the whole substrate-docking region [16].
Five TAXI-I loop regions completely cover the deep
substrate-binding and active site cleft of the endoxyla-
nase through ionic and hydrophobic interactions and
hydrogen bonding (including water-bridged contacts)
[16] (Fig. 1A), resulting in the burial of 992 A
˚
2
of
accessible surface area. The imidazole ring of TAXI-I
His374 that fits into the active site of the enzyme and,
more precisely, in between the two catalytic Glu
AB
Fig. 1. (A) Ribbon diagram of the overall structure of TAXI-I (orange) in complex with A. niger endoxylanase (blue) [16]. The interaction site is
boxed and interface residues His374 and Leu292 of TAXI-I and Asp37, Glu79 and Glu170 of A. niger endoxylanase are shown in sticks.
(B) Detailed view on the key interactions. The imidazole ring of TAXI-I His374 fits in between the two catalytic residues (Glu79 and Glu170)
of A. niger endoxylanase and is highly stabilized through ionic, salt bridge and hydrogen bonding interactions with both residues and Asp37
of the endoxylanase.
K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition
FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5873
residues involved in substrate hydrolysis is the key resi-
due for endoxylanase inhibition (Fig. 1B). In the )2
glycon subsite of the endoxylanase, Leu292 of TAXI-I
perfectly superimposes with xylose.
In spite of the above, profound analysis of the speci-
fic contributions of the amino acid residues at the
interface of the enzyme–inhibitor interaction is lacking.
Mutagenesis studies of a GH11 Bacillus subtilis endo-
xylanase revealed that both the ‘thumb’ and ‘finger’
regions of the enzyme are important for interaction
with TAXI-type inhibitors [12]. Tahir and coworkers
[24] showed that mutation of the pH-optimum related
Asp37 in the active site cleft of a GH11 A. niger endo-
xylanase into Ala completely abolishes interaction with
TAXI-I.
Mutational analysis of TAXI-I rather than of its
target enzymes is another approach to study the struc-
tural requirements for formation of the enzyme–inhib-
itor complex and for identifying the nature of forces
involved in its stabilization. In the present case,
His374 of TAXI-I is a critical residue for endoxyla-
nase inhibition because of its many interactions with
several endoxylanase residues [16]. Hence, we investi-
gated its role in the endoxylanase–inhibitor interaction
by site-directed mutagenesis. Residual endoxylanase
inhibition activities of the TAXI His374 mutants were
determined. The specific contribution of TAXI-I
His374 in endoxylanase interaction was examined
using surface plasmon resonance (SPR) analysis. The
need for interface charges and the pH stability of the
enzyme–inhibitor interaction were studied by IEF
titration curves.
Results and Discussion
Recombinant expression, purification and
characterization of TAXI
[H374A/K/Q]
mutants
The role of TAXI-I His374 in endoxylanase inhibition
was studied by site-directed mutagenesis of this residue
into Ala (A), Gln (Q) or Lys (K). Ala is mostly used
for amino acid substitutions because of its small size
and aliphatic properties. Crystallographic analysis of
the A. niger endoxylanase–TAXI-I complex showed
involvement of the two nitrogen atoms of the His374
imidazole ring of TAXI-I in endoxylanase interaction
[16]. Moreover, molecular identification of TAXI-II
proteins showed the presence of either His or Gln at
this position [25]. For that reason, positively charged
and basic His374 was replaced by Gln and Lys both
containing one nitrogen atom in their side chain. The
Gln nitrogen superimposes with the distal imidazole
nitrogen while Lys cannot superimpose similarly but,
like His, has a positive charge. Mutant TAXI-I pro-
teins were overexpressed in Pichia pastoris and purified
to homogeneity as described previously [26]. From a
100 mL culture of each of the yeast transformants,
about 3–5 mg of purified protein was obtained, similar
to the yield obtained for wild-type TAXI-I [26]. Each
of the purified mutants exhibited a single band with
molecular mass ( 42 kDa) similar to that of the wild-
type protein on SDS ⁄ PAGE. The isoelectric point of
all mutants was at least 9.3. CD spectra (Fig. 2) for
mutants TAXI
[H374A]
and TAXI
[H374K]
were similar to
that of wild-type TAXI-I indicating that there were no
major structural perturbations caused by the muta-
tions. No CD spectrum was recorded for TAXI
[H374Q]
.
However, as the protein still showed endoxylanase
inhibition activity (cfr. infra), the overall protein
structure was expected to be similar like those of wild-
type TAXI-I and the mutants TAXI
[H374A]
and
TAXI
[H374K]
.
Endoxylanase inhibition activity of the TAXI-I
mutants
Specific endoxylanase inhibition activities of the
TAXI-I His374 mutants were determined for a defined
set of GH11 endoxylanases (Table 1). Endoxylanase
selection was based on high sensitivity for wild-type
TAXI-I inhibition [12,15,22]. Endoxylanases from
A. niger, Penicillium funiculosum, Trichoderma longi-
brachiatum and B. subtilis were all strongly inhibited
by wild-type TAXI-I with specific inhibition activities
ranging from 2900 to 4400 IUÆmg
)1
protein. The
TAXI-I His374 mutants, however, exerted large differ-
ences in endoxylanase inhibition activities. A. niger
-250
-200
-150
-100
-50
0
50
180 190 200 210 2 20 230 240 250 260
Wavelength (nm)
[
θ
θ
θ
θ
]
(10
-4
deg.cm
2
.decimole
-1
)
Fig. 2. CD spectra of wild-type TAXI-I (dotted line) and TAXI-I
mutants TAXI
[H374A]
(bold line) and TAXI
[H374K]
(broken line). The
spectra were normalized to the protein concentration and
expressed as molar ellipticity [h].
Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al.
5874 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS
endoxylanase inhibition activity was not detected for
any of the three mutants even when, in the inhibition
assay, 10 times more inhibitor was used than for wild-
type TAXI-I. All mutants still strongly inhibited
P. funiculosum endoxylanase with specific inhibition
units ranging from 2500 to 2900 per mg protein.
T. longibrachiatum M3 endoxylanase was strongly
inhibited by TAXI
[H374A]
and TAXI
[H374Q]
, but only
weakly by TAXI
[H374K]
. The latter TAXI-I mutant
exerted low endoxylanase inhibition activities for all
GH11 endoxylanases tested with exception of the one
from P. funiculosum. The lysine side chain probably
does not optimally fit into the active site of the
endoxylanases. Both mutants TAXI
[H374A]
and
TAXI
[H374Q]
showed reduced inhibition activities
against B. subtilis and T. longibrachiatum M2 endoxy-
lanases.
Real-time interactions of wild-type TAXI-I and
TAXI-I His374 mutants with GH11 endoxylanases
studied by SPR analysis
SPR measurements were performed to further investi-
gate the specific contribution of TAXI-I His374 to
complexation with three industrially important GH11
endoxylanases. Real-time interactions between A. niger,
T. longibrachiatum M2, B. subtilis GH11 endoxylanases
and wild-type TAXI-I and mutants TAXI
[H374A]
,
TAXI
[H374K]
, TAXI
[H374Q]
were determined. Figure 3
shows representative real-time binding sensorgrams.
Equilibrium dissociation constants (K
D
) were calculated
from the ratio of dissociation rate constants over
association rate constants (k
off
⁄ k
on
) and were in the
low nanomolar range (Table 2).
K
D
values of the complexes between wild-type
TAXI-I and A. niger or B. subtilis endoxylanase
(K
D[A. niger]
6 3.77 nm, K
D[B. subtilis]
¼ 1.07 nm) were,
respectively, five- and 17-fold lower than the inhibition
constants (K
i[A. niger]
¼ 20.1 nm, K
i[B. subtilis]
¼ 16.7 nm)
previously measured by endoxylanase inhibition assays
using water-soluble wheat AX as substrate [12]. Differ-
ences may be due to different experimental conditions,
including absence ⁄ presence of substrate, reaction tem-
peratures (difference of 8 °C) and use of different
measurement techniques. A closer look at the SPR
results revealed differences in endoxylanase affinity.
The wild-type inhibitor has a threefold higher affinity
for B. subtilis than for A. niger endoxylanase (K
D
val-
ues of 1.07 nm vs. 3.77 nm, respectively).
Mutation of TAXI-I His374 clearly affected the
interaction between enzyme and inhibitor. In contrast
to what could be predicted from the obtained specific
endoxylanase inhibition activity results, mutants
TAXI
[H374A]
and TAXI
[H374Q]
still showed affinity
(albeit reduced) for A. niger endoxylanase. However,
no A. niger endoxylanase interaction was observed for
TAXI
[H374K]
. The k
on
rate constant for TAXI
[H374A]
Table 1. Specific inhibition units (SD ¼ 10%, n ¼ 3) of TAXI-I and
TAXI-I His374 mutants for GH11 endoxylanases (endoxylanase
selection was based on high sensitivity for wild-type TAXI-I inhibi-
tion [12,15,22]. Endoxylanase inhibition activities were determined
with a routinely used variant of the colorimetric Xylazyme-AX
method using Xylazyme-AX tablets as substrate. One enzyme unit
(EU) corresponded to an increase in absorbance of 1.0 at 590 nm
under the conditions of the assay. One inhibition unit (IU) was
defined as the amount of inhibitor that, under the conditions of the
assay, reduces the A
590
of one EU by 50% (to 0.5). Inhibition activ-
ities were determined with 0–10 nm wild-type and 0–60 nm mutant
TAXI-I.
GH11 endoxylanase
Specific inhibition units (IUÆmg protein
)1
)
TAXI-I TAXI
[H374A]
TAXI
[H374Q]
TAXI
[H374K]
A. niger 3600 < 20
a
<20
a
<20
a
P. funiculosum 3700 2500 2900 2800
T. longibrachiatum M2 4400 500 1300 100
T. longibrachiatum M3 3200 3700 2900 60
B. subtilis 2900 200 300 20
a
No endoxylanase inhibition activity detected.
A
1200 nM
600 nM
300 nM
150-50
Time (s)
350 550 750 950 1150
300
260
Response (RU)
220
180
140
100
60
20
-20
-60
B
200 nM
307 nM
100 nM
150-50
Time (s)
350 550 750 950 1150
Response (RU)
350
300
250
200
150
100
50
0
-50
C
500
400
100
0
600
Response (RU)
307 nM
200 nM
100 nM
150-50
Time (s)
350 550 750 950 1150
200
300
Fig. 3. Representative real-time binding sensorgrams measured by SPR and showing the interaction between (A) A. niger endoxylanase and
TAXI-I, (B) B. subtilis endoxylanase and TAXI-I, and (C) B. subtilis endoxylanase and TAXI
[H374Q]
. Varying endoxylanase concentrations were
injected over immobilized TAXI-I (A and B) and TAXI
[H374Q]
(C) as indicated on the sensorgrams. The measurements were performed at
22 °C in 100 m
M sodium acetate pH 5.0.
K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition
FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5875
was about three times lower than that of wild-type
TAXI-I, while the association rate constant of
TAXI
[H374Q]
was only slightly affected. Large differ-
ences were found in the dissociation rate constants
with k
off
values for TAXI
[H374A]
and TAXI
[H374Q]
that
showed about a 50- and 80-fold increase, respectively,
over the constant of wild-type TAXI-I. Consequently,
the K
D
values for both mutants were at least 95-fold
higher, indicating weaker affinity of the TAXI-I
mutants than wild-type TAXI-I for A. niger endoxyla-
nase. Lower affinity may explain the absence of
A. niger endoxylanase inhibition by the TAXI-I
His374 mutants in the inhibition assay because the
amount of mutated inhibitor used was too low.
Indeed, in another experiment, 100-fold excess of
mutated inhibitor (TAXI
[H374A]
or TAXI
[H374Q]
)
slightly reduced the A. niger endoxylanase activity
(results not shown).
Reduced affinity was also observed for the interac-
tion of the TAXI-I His374 mutants with T. longibra-
chiatum M2 and B. subtilis endoxylanases. However,
mutation of TAXI-I His374 did more markedly affect
the k
on
rate constants of the interaction with B. subtilis
endoxylanase than the k
on
rate constants of the inter-
actions with A. niger or T. longibrachiatum M2
endoxylanases. At the same time, the increase in k
off
values was less pronounced for B. subtilis endoxylanase
than for either the A. niger or T. longibrachiatum M2
endoxylanase. However, the range of k
off
increases was
still larger than the decrease in their respective k
on
rate
constants.
Hence, mutation of TAXI-I His374 weakened the
affinity of the enzyme–inhibitor interaction. This was
clearly reflected in the drastic increase in k
off
and K
D
constants. The smaller effect on the k
on
rate constants
indicated that TAXI-I His374 is less critical for dock-
ing of the inhibitor onto the enzyme. Crystallographic
analysis of the TAXI-I–A. niger endoxylanase complex
[16] showed that the two nitrogen atoms of the TAXI-
I His374 imidazole ring strongly interact with several
endoxylanase residues (Fig. 1B). They are highly sta-
bilized through salt bridge and hydrogen bond interac-
tions with Asp37, a residue known to determine the
acidic enzymic pH optimum [8], and ionic interactions
with the nucleophilic catalyst Glu79 of the endoxyla-
nase (Fig. 1B). In addition, strong hydrogen bond
interactions were observed for TAXI-I His374 and
acid ⁄ base catalyst Glu170 of the endoxylanase. As
mutation of TAXI-I His374 most affected the k
off
rate
constants, it seems that both nitrogen atoms of the
TAXI-I His374 imidazole ring provide additional
stabilization once the enzyme–inhibitor complex is
formed. This is especially true for A. niger endoxyla-
nase as the K
D
values of its interaction with all TAXI-
I His374 mutants largely increased. Our assumption
was convincingly demonstrated by the binding behav-
ior of TAXI-I mutants TAXI
[H374A]
and TAXI
[H374Q]
(Table 2). The side chain of Gln (containing one nitro-
gen atom) probably accounts for additional hydrogen
bonding interactions compared to the aliphatic side
chain of Ala, resulting in stronger complex formation
and lower equilibrium dissociation constants for
TAXI
[H374Q]
than for TAXI
[H374A]
. The higher K
D
val-
ues for TAXI
[H374K]
may be due to difficult fitting and
stabilization problems of the flexible and long Lys side
chain into the endoxylanase active site cleft despite the
presence of one positively charged nitrogen atom in its
terminal amino group.
Table 2. Kinetic parameters of the binding of TAXI-I and its mutants to GH11 endoxylanases. Association rate constants (k
on
), dissociation
rate constants (k
off
) and equilibrium dissociation rate constants (K
D
¼ k
off
⁄ k
on
) were derived from SPR data using Biacore software. The data
were fitted to the 1 : 1 Langmuir binding model. The rate constants represent the average of measurements with three different endoxyla-
nase concentrations performed at least in duplicate (±
SD). Measurements were performed at 22 °C in 100 mM sodium acetate pH 5.0.
TAXI-I TAXI
[H374A]
TAXI
[H374Q]
TAXI
[H374K]
A. niger endoxylanase
k
on
(10
4
M
)1
Æs
)1
) 1.96 ± 0.48 0.72 ± 0.15 1.59 ± 0.35 No binding detected
k
off
(10
)4
s
)1
) 6 0.72 ± 0.42 39.1 ± 17.6 56.1 ± 13.2
K
D
(10
)9
M) 6 3.77 ± 2.00 545 ± 208 360 ± 82.5
T. longibrachiatum M2 endoxylanase
k
on
(10
4
M
)1
Æs
)1
) 5.35 ± 2.32 3.37 ± 1.82 3.72 ± 1.73 2.80 ± 1.62
k
off
(10
)4
s
)1
) 6 0.82 ± 0.35 14.7 ± 3.43 3.25 ± 0.21 60.0 ± 19.8
K
D
(10
)9
M) 6 1.84 ± 1.05 55.3 ± 30.2 10.8 ± 5.42 551 ± 916
B. subtilis endoxylanase
k
on
(10
4
M
)1
Æs
)1
) 36.1 ± 10.6 11.7 ± 6.84 25.6 ± 13.3 4.57 ± 1.52
k
off
(10
)4
s
)1
) 3.60 ± 0.43 15.9 ± 1.90 11.8 ± 1.00 34.4 ± 6.70
K
D
(10
)9
M) 1.07 ± 0.32 17.0 ± 7.45 6.58 ± 4.68 81.6 ± 29.9
Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al.
5876 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS
Interface charges and pH stability of the
enzyme–inhibitor interaction studied by IEF
titration curves
The above results indicated that, especially for A. niger
endoxylanase, electrostatic interactions are important
for stabilization of the enzyme–inhibitor complex. The
need for interface charges and the pH-stability of the
enzyme–inhibitor interaction were therefore studied in
the pH range pH 3.0–9.0 by IEF titration curves of
enzyme, inhibitor and their complex. Pre-incubation of
wild-type TAXI-I and A. niger endoxylanase at pH 5.0
resulted in the formation of an enzyme–inhibitor com-
plex stable in a pH range from pH 3.0–7.0 (Fig. 4).
Above pH 7.0, the complex dissociated. The complexes
of TAXI-I with endoxylanases from B. subtilis or
T. longibrachiatum M2 were stable in the entire pH
range tested from pH 3.0–9.0, respectively (Fig. 4).
These results show that the weaker A. niger endoxyla-
nase–TAXI-I complex also is more susceptible to pH–
B. subtilis
endoxylanase
complex
TAXI-I
mobility
3
9
p
H
3
9
p
H
3
9
p
H
mobility mobility
3
9
pH
TAXI-I
complex
E
T. longibrachiatum
M2 endoxylanase
complex
3
9
pH
D
GHF
BCA
A. niger
endoxylanase
complex
A. niger
endoxylanase
TAXI
-
I
TAXI
-
I
3
9
pH
3
9
pH
3
9
pH
Fig. 4. IEF titration curves of TAXI-I, alone or in the presence of endoxylanases from A. niger, T. longibrachiatum M2 or B. subtilis.(A)
A. niger endoxylanase, (B) a mixture of TAXI-I and A. niger endoxylanase with excess of TAXI-I, (C) TAXI-I, (D) a mixture of TAXI-I and
T. longibrachiatum M2 endoxylanase with excess of enzyme, (E) a mixture of TAXI-I and T. longibrachiatum M2 endoxylanase with excess
of inhibitor, (F) B. subtilis endoxylanase, (G) a mixture of B. subtilis endoxylanase and TAXI-I and (H) TAXI-I.
K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition
FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5877
induced changes in interface charges. The pH-depend-
ent stability of this enzyme-inhibitor complex cannot
easily be rationalized since stability is reflected in the
titration of several residues in the active site of the
endoxylanase and TAXI-I itself. However, it can be
partially explained by the weakened affinity of the
TAXI-I His374 mutants for GH11 endoxylanases indi-
cating that the presence of normally charged TAXI-I
His374 is of utmost importance for hydrogen bonding
and salt bridge interactions with Glu79, Glu170 and
Asp37 of A. niger endoxylanase. These results are in
perfect agreement with structural data of the A. niger
endoxylanase–TAXI-I complex [16] and with results of
Tahir and coworkers [24] who found that mutation of
the negatively charged and pH-optimum related Asp37
of A. niger endoxylanase into neutral Ala completely
abolishes interaction with TAXI-I. Recent data by
Raedschelders et al. [25] showed the functional import-
ance of His374 in the interaction between TAXI-type
proteins and A. niger endoxylanase. Moreover, the
TAXI combination His374 ⁄ Leu292 is required for
A. niger endoxylanase inhibition by TAXI-type pro-
teins. In a pH range 3.0–9.0, changes in interface
charges are less critical for stabilization of the enzyme–
inhibitor complexes of wild-type TAXI-I and endo-
xylanases from B. subtilis or T. longibrachiatum M2 as
such complexes were stable between pH 3.0–9.0.
Indeed, SPR data showed that the increase in k
off
rate
constants was smaller for B. subtilis and T. longibrachi-
atum M2 endoxylanases than for interaction with
A. niger endoxylanase. Hence, the IEF titration curves
were in perfect agreement with the SPR analyses of the
endoxylanase–TAXI-I interaction.
Our results suggest that TAXI-I His374 is important
for stabilization of the formed enzyme–inhibitor com-
plex. Mutation of this amino acid residue to a variable
degree affects the affinity of the enzyme–inhibitor
interaction. Inhibition activity remains upon mutation
of TAXI-I His374 for endoxylanases from P. funiculo-
sum and T. longibrachiatum M3. This is strong evi-
dence for additional inhibition determinants in the
TAXI-I protein. Based on structural data [16], possible
candidates are the neighboring amino acid residues of
TAXI-I His374 such as Phe375 and Thr376 and the
residues situated on another endoxylanase interaction
TAXI-I loop, e.g. amino acid Leu292 as shown
recently for A. niger endoxylanase [25]. Determination
of the crystal structures of TAXI-I complexed with dif-
ferent GH11 endoxylanases and mutational analysis of
enzyme and inhibitor would provide insight in the cur-
rently observed differences in enzyme-inhibitor affinity.
In this way, the exact mechanism of endoxylanase inhi-
bition by TAXI-I and the specific contributions of the
amino acid residues at the interface of the enzyme–
inhibitor complex would be unravelled.
Conclusions
Endoxylanase inhibition by TAXI-I is due to a speci-
fic, reversible, high-affinity (in the nanomolar range)
1 : 1 stoichiometric interaction between GH11 endo-
xylanases and TAXI-I. In addition to structural data
of an A. niger endoxylanase–TAXI-I complex [16],
site-directed mutagenesis studies showed that TAXI-I
His374 plays an important role in the stabilization of
the enzyme–inhibitor complex rather than in the dock-
ing of the inhibitor onto the enzyme. It is also conclu-
ded that TAXI-I His374 is not the sole critical amino
acid residue for endoxylanase inhibition. The work
proved that substitution of a single specific amino acid
residue strongly affects the affinity of the inhibitor for
the enzyme. This fact opens new perspectives for devel-
opment of novel TAXI mutants with adapted endo-
xylanase specificity.
Experimental procedures
Materials
Primers were from Proligo Primers and Probes (Paris,
France) and restriction enzymes were from Roche Diagnos-
tics (Basel, Switzerland). Escherichia coli TOP10 (Invitro-
gen, Carlsbad, CA, USA) cells were used for cloning while
Pichia pastoris strain X33 (Invitrogen) was used for protein
expression experiments. GH11 endoxylanases were from
Aspergillus niger (M4 from Megazyme (Bray, Ireland),
Swissprot P55329), Bacillus subtilis (Grindamyl H640 from
Danisco (Brabrand, Denmark), Swissprot P18429), Tricho-
derma longibrachiatum (formerly T. reesei) (M2 and M3
from Megazyme, Swissprot P36218 and P36217, respect-
ively), Penicillium funiculosum (xynC, GenBank acc. num-
ber CAC15487; kind gift from C. Furniss, I.F.R., Norwich,
UK) and Trichoderma viride (M1 from Megazyme, Swiss-
prot AJ012718).
Site-directed mutagenesis of TAXI-I His374:
plasmid construction and P. pastoris
transformation
The contribution of amino acid His374 of TAXI-I to endo-
xylanase inhibition was studied by mutation of this amino
acid residue into alanine, lysine or glutamine. Site-directed
mutagenesis was performed using a ‘two-round’ PCR
method for mutants H374A and H374K. As His374 is situ-
ated near the end of the TAXI-I coding sequence [19], a
first round PCR reaction was performed incorporating the
Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al.
5878 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS
H374A mutation with a reverse primer and amplifying the
complete TAXI-I coding sequence except its C-terminal
end. In a second PCR reaction, the complete coding
sequence was amplified with a reverse primer that over-
lapped with the first PCR product. PCR reactions were per-
formed in 30 lL using 2 units cloned Pfu DNA polymerase
(Stratagene, La Jolla, CA, USA), commercially supplied
buffer, 200 lm of each dNTP, 1 lm of each primer and
5 ng of template DNA. The reaction mixtures were incuba-
ted for 2 min at 95 °C, followed by 35 cycles of 1 min
at 95 °C (dissociation), 90 s at 47 °C (annealing), 2 min at
72 °C (extension), and a final extension step for 20 min
at 72 °C on a Mastercycler gradient (Eppendorf, Hamburg,
Germany). For the first round of PCR, plasmid pQE16-
SSPelB TAXI-I [19] was used as DNA template together
with forward primer XIF1 (Table 3), comprising a BglII
restriction site, and reverse mutagenic primer XI019
(Table 3) to incorporate the mutations. The obtained PCR-
product was gel-purified using the QIAquick Gel Extraction
Kit (Qiagen) and used as DNA template for the final PCR
round. The coding sequence of TAXI
[H374A]
was amplified
completely using forward primer XIF1 and reverse primer
XIR2 (Table 3), both comprising BglII restriction sites, and
the same PCR conditions as above. Again, the PCR prod-
uct was gel-purified and 3¢A-overhangs were added with 1
Unit Supertaq DNA polymerase (SphaeroQ, Leiden, the
Netherlands) during 10 min at 72 °C. The PCR product
was cloned in the pCRÒ4-TOPOÒ TA cloning vector
(Invitrogen) according to the manufacturer’s instructions.
Vectors with insert were retained and sequenced on a 377
DNA Sequencer using ABI PRISM Big Dye Terminator
chemistry (Applied Biosystems, Foster City, CA, USA) and
vector-specific primers. A BglII-restricted TAXI-H374A
insert was cloned into the BsmBI restriction site of the
P. pastoris pPICZaC vector (Invitrogen) for protein secre-
tion. Proper insert orientation was verified by restriction
digestion and sequencing. Mutant TAXI
[H374K]
was pre-
pared in the same way. Only for the first round of PCR,
forward primer XIF1 and reverse mutagenic primer XI022
(Table 3) were used.
For the construction of the TAXI
[H374Q]
mutant, the
QuikChangeÒ Site-Directed Mutagenesis Kit (Stratagene)
was used. One pair of complementary mutant primers
XI036 and XI037 (Table 3) was used for the amplification
and introduction of mutation H374Q into the pPICZaC-
TAXI-I plasmid [26]. All reactions were performed accord-
ing to the manufacturer’s instructions. The obtained vector
was sequenced to confirm the desired mutation.
The vectors pPICZaC-TAXI-H374A ⁄ K ⁄ Q were linea-
rized with Pme I and used for transformation by means of
homologous recombination of the P. pastoris X33 genome
according to the EasyComp
TM
Transformation protocol
(Invitrogen). Genomic DNA of Zeocin
TM
-resistant Pichia
transformants was isolated [27] and incorporation of the
mutant TAXI-I gene was determined by PCR using vector-
specific primers and HotStarTaq DNA polymerase (Invitro-
gen).
Expression and purification of TAXI-I and TAXI-I
mutants
Recombinant X33 TAXI-I and TAXI-I His374 mutants
were produced in P. pastoris and purified using cation
exchange and gel filtration chromatography as described by
Fierens et al. [26].
Purification of GH11 endoxylanases for IEF
titration curve analysis and SPR
Endoxylanases from B. subtilis (extract of 1.0 g Grindamyl
H640 in 5 mL 25 mm sodium acetate buffer pH 5.0),
A. niger (1.0 mL, M4 from Megazyme) and T. longibrachia-
tum M2 (1.0 mL, Megazyme) were purified to homogeneity
using gel filtration chromatography. Endoxylanase samples
were loaded on a Bio-Gel P-30 Gel fine (BioRad, Hercules,
CA, USA, 16 mm · 65 cm) column and fractionated at
0.2 mLÆmin
)1
using 250 mm sodium acetate buffer pH 5.0.
Highly pure endoxylanase fractions were used for IEF titra-
tion curve analysis and SPR.
Protein concentration determination
Protein concentrations of purified proteins were determined
by measuring the absorbance at 280 nm. The molar extinc-
tion coefficients (m
)1
Æcm
)1
) were calculated from the amino
acid sequences using the protparam tool [28]. The absor-
bances, corresponding to a protein concentration of
1.000 mgÆmL
)1
, are 4.013 AU (B. subtilis endoxylanase),
2.526 AU (A. niger endoxylanase), 2.464 AU (T. longibra-
chiatum M2 endoxylanase), 0.763 AU (TAXI-I), 0.764
(TAXI
[H374A]
), 0.763 AU (TAXI
[H374K]
) and 0.763 AU
(TAXI
[H374Q]
), respectively.
Endoxylanase inhibition assay
Endoxylanase inhibition activities were determined with a
routinely used variant of the colorimetric Xylazyme-AX
method as described by Fierens et al. [26]. The endoxylanases
Table 3. Primers used for TAXI-I mutational analysis. Mutagenic
bases and restriction sites are in bold and underlined, respectively.
Name Sequence
XIF1 CCA
AGATCTCTTCCGGTGCTCGCTCCG
XIR2 CCT
AGATCTTTACAGGCCGCCGCAACCCGTAAAG
XI019 CCGCAACCCGTAAAGGCCGGCAGCCTG
XI022 CCGCAACCCGTAAACTTCGGCAGCCTG
XI036 GCAGGCTGCCGCAATTTACGGG
XI037 CCCGTAAATTGCGGCAGCCTGC
K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition
FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5879
were diluted in sodium acetate buffer (25 mm, pH 5.0)
with 0.5 mgÆmL
)1
bovine serum albumin (BSA). Inhibitor
fractions were dissolved in 25 mm sodium acetate buffer
(pH 5.0). One enzyme unit (EU) corresponded to an
increase in absorbance of 1.0 at 590 nm under the condi-
tions of the assay. One inhibition unit (IU) was defined as
the amount of inhibitor that, under the conditions of
the assay, reduces the A
590
of one EU by 50% (to 0.5). All
inhibition activity measurements were performed in tripli-
cate.
CD spectroscopy
CD spectra of TAXI-I, TAXI
[H374A]
and TAXI
[H374K]
were
recorded with a JASCO Spectropolarimeter (J-810) (JASCO
Benelux, B.V., Maarssen, the Netherlands) at room tem-
perature using a 0.1 mm quartz cell path length. Three
scans in the far-UV (260–180 nm) were recorded for each
protein sample and averages are reported. The obtained
ellipticities were expressed as molar ellipticities. Pure pro-
tein samples of TAXI-I, TAXI
[H374A]
and TAXI
[H374K]
were
prepared in phosphate buffer (10 mm, pH 6.0) at concen-
trations of 17.5 lm, 17.0 lm and 16.8 lm, respectively.
Surface plasmon resonance (SPR) analysis
SPR allows direct visualization of real–time interactions
and, hence, determination of complex association (k
on
) and
dissociation (k
off
) rate constants. The kinetics of binding
between TAXI-I wild-type, TAXI
[H374A ⁄ K ⁄ Q]
mutants and
GH11 endoxylanases from A. niger, B. subtilis and T. longi-
brachiatum M2 were analyzed in real time by SPR using a
BIAcore 3000 (BIAcore, Uppsala, Sweden) system. Ran-
dom amine coupling of TAXI-I wild-type and mutants was
carried out by injecting the proteins (10 lgÆmL
)1
each) in
10 mm sodium acetate, pH 5.0, following preactivation of
the carboxymethylated dextran matrix (CM5 sensor chip)
using N-hydroxysuccinimide (NHS) ⁄ N-ethyl-N¢-[3-(diethyl-
amino)propyl]carbodiimide. After injection of the proteins,
the residual NHS esters were deactivated by the injection of
25 lL of ethanolamine (1 m, pH 8.5).
BIAcore 3000 sensorgrams [resonance units (RU) versus
time] were recorded at a flow rate of 30 lL Æmin
)1
at room
temperature (22 °C), using different concentrations of
analytes (A. niger endoxylanase: 300 nm, 600 nm, 1200 nm,
2205 nm; B. subtilis endoxylanase: 100 nm, 200 n m, 307 n m;
T. longibrachiatum M2 endoxylanase: 50 nm, 100 nm, 200
nm) in sodium acetate running buffer (100 mm, pH 5.0).
The runs were at least in duplicate for each analyte concen-
tration using sensor chips coupled with 1200–1400 RU of
protein. One RU corresponds to 1 pg of bound pro-
tein ⁄ mm
2
. Association and dissociation data were both col-
lected for 8 min. The sensor chips were regenerated at the
end of each run by one 10 lL injection of 50 mm sodium
hydroxide pH 12.0. Data obtained from parallel flow cells
with coupled thrombin activatable fibrinolysis inhibitor [29]
served as blank sensorgrams for subtraction of changes in
the bulk refractive index.
The sensorgrams were analyzed using biaevaluation ver-
sion 3.1 software that provides both numerical integration
and global fitting algorithms. The data were fitted
to a single-site interaction model [1:1 (Langmuir) binding:
A+B« AB]. Assuming pseudo-first-order interaction kin-
etics, the rate of complex formation during sample injection
is given by d[AB] ⁄ dt ¼ k
on
[A][B] – k
off
[AB], which may be
expressed as dR ⁄ dt ¼ k
on
CR
max
–(k
on
C+k
off
)R, where
dR ⁄ dt is the rate of change of the SPR signal, C is the con-
centration of analyte, R
max
is the maximum analyte binding
capacity in RU, and R is the recorded SPR signal in RU at
time t. k
off
values were determined from the data collected
during the dissociation phase (dR ⁄ dt ¼ -k
off
R), while k
on
values were derived from the above rate equation for
complex formation. The equilibrium dissociation (K
D
) con-
stants were calculated from the kinetic rate constants
(K
D
¼ k
off
⁄ k
on
). Details of the rate equations are described
in the BIAevaluation version 3 software manuals.
IEF titration curve analysis
IEF titration curve analysis was performed with the Phast-
System
TM
(Amersham Biosciences, Uppsala, Sweden). Pro-
tein samples were applied on a PhastGel IEF 3–9
(Amersham Biosciences). In the first dimension, carrier
ampholytes contained in the gel were subjected to an elec-
tric field (2000 V, 2.5mA, 3.5 W, 15 °C and 150 Vh) to gen-
erate a pH gradient (3–9). The gel was then rotated
clockwise 90°, and the protein sample was applied perpen-
dicular to the pH gradient. The focusing step was then
performed (1000 V, 2.5mA, 0.2 W, 15 °C and 40–50Vh).
Protein samples (1–5 ng of inhibitor, endoxylanase or endo-
xylanase–inhibitor complex ⁄ well) were solubilized in 25 mm
sodium acetate buffer (pH 5.0) and incubated during
30 min at room temperature before applying them onto the
gel. Finally, proteins were silver stained as described in
Amersham Biosciences’ development technique file 210.
Acknowledgements
The authors thank Dr Y. Engelborghs and M. Hellings
(Laboratory of Biomolecular Dynamics, K.U. Leuven,
Leuven, Belgium) for helpful discussions and technical
assistance concerning the CD spectra measurements.
We gratefully acknowledge Griet Compernolle for
technical assistance with the SPR analyses. Financial
support was obtained from the ‘Bijzonder Onder-
zoeksfonds’ (K.U. Leuven, Belgium). This study was
carried out in the framework of research project
GOA ⁄ 03⁄ 10 financed by the Research Fund K.U. Leu-
ven and with financial support from the ‘Fonds voor
Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al.
5880 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS
Wetenschappelijk onderzoek-Vlaanderen’ (F.W.O. Vla-
anderen, Brussels, Belgium). A.G., K.G., A.R and
S.V.C. are postdoctoral fellows of the F.W.O. Vlaand-
eren. GBOU project funding by the ‘Instituut voor de
aanmoediging van Innovatie door Wetenschap en
Technologie in Vlaanderen’ (I.W.T., Brussels, Belgium)
is gratefully acknowledged.
References
1 Kulkarni N, Shendye A & Rao M (1999) Molecular
and biotechnological aspects of xylanases. FEMS
Microbiol Rev 23, 411–456.
2 Fincher GB & Stone BA (1986) Cell walls and their
components in cereal grain technology. In Advances in
Cereal Science and Technology, pp. 207–295. American
Association of Cereal Chemists: St Paul, Minnesota,
USA.
3 Coutinho PM & Henrissat B (1999) Carbohydrate-
active enzymes: an integrated database approach. In
Recent Advances in Carbohydrate Bioengineering
(Gilbert HJ, Davies G, Henrissat B & Svensson B,
eds), pp. 3–12. The Royal Society of Chemistry,
Cambridge, UK.
4To
¨
rro
¨
nen A, Harkki A & Rouvinen J (1994) Three-
dimensional structure of endo-1,4-b-xylanase II from
Trichoderma reesei: two conformational states in the
active site. EMBO J 13, 2493–2501.
5 Simpson DJ, Fincher GB, Huang AHC & Cameron-
Mills V (2002) Structure and function of cereal and
related higher plant (1 fi 4)-b-xylan endohydrolases.
J Cereal Sci 37, 111–127.
6 Derewenda U, Swenson L, Green R, Wei Y, Morosoli
R, Shareck F, Kluepfel D & Derewenda ZS (1994)
Crystal structure, at 2.6 A
˚
resolution, of the Strepto-
myces lividans xylanase A, a member of the F family of
b-1,4-d-glycanases. J Biol Chem 269, 20811–20814.
7 Sinnot ML (1990) Catalytic mechanisms of enzymic
glycosyl transfer. Chem Rev 90, 1171–1202.
8 Krengel U & Dijkstra BW (1996) Three-dimensional
structure of endo-1,4-b-xylanase I from Aspergillus
niger: molecular basis for its low pH optimum. J Mol
Biol 263, 70–78.
9 Christophersen C, Andersen E, Jacobsen TS & Wagner
P (1997) Xylanases in wheat separation. Starch ⁄ Sta
¨
rke
1, 5–12.
10 Courtin CM & Delcour JA (2002) Arabinoxylans and
endoxylanases in wheat flour bread-making. J Cereal
Sci 35, 225–243.
11 Bedford MR & Schulze H (1998) Exogenous enzymes
for pigs and poultry. Nutr Res Rev 11, 91–114.
12 Gebruers K, Brijs K, Courtin CM, Fierens K, Goesaert
H, Rabijns A, Raedschelders G, Robben J, Sansen S,
Sørensen JF et al. (2004) Properties of TAXI-type endo-
xylanase inhibitors. Biochim Biophys Acta 1696, 213–
221.
13 Goesaert H, Elliott G, Kroon PA, Gebruers K, Courtin
CM, Robben J, Delcour JA & Juge N (2004) Occur-
rence of proteinaceous endoxylanase inhibitors in
cereals. Biochim Biophys Acta 1696, 193–202.
14 Juge N, Payan F & Williamson G (2004) XIP-I, a xyla-
nase inhibitor protein from wheat: a novel protein func-
tion. Biochim Biophys Acta 1696, 203–211.
15 Gebruers K, Debyser W, Goesaert H, Proost P, Van
Damme J & Delcour JA (2001) Triticum aestivum L.
endoxylanase inhibitor (TAXI) consists of two inhibi-
tors, TAXI I and TAXI II, with different specificities.
Biochem J 353, 239–244.
16 Sansen S, De Ranter CJ, Gebruers K, Brijs K, Courtin
CM, Delcour JA & Rabijns A (2004) Structural basis
for inhibition of Aspergillus niger xylanase by Triticum
aestivum xylanase inhibitor-I. J Biol Chem 279, 36022–
36028.
17 McLauchlan WR, Garcia-Conesa MT, Williamson G,
Roza M, Ravestein P & Maat J (1999) A novel class of
protein from wheat which inhibits xylanases. Biochem J
338, 441–446.
18 Payan F, Flatman R, Porciero S, Williamson G, Juge N
& Roussel A (2003) Structural analysis of xylanase inhi-
bitor protein I (XIP-I), a proteinaceous xylanase inhibi-
tor from wheat (Triticum aestivum, var. Soisson).
Biochem J 372, 399–405.
19 Fierens K, Brijs K, Courtin CM, Gebruers K, Goesaert
H, Raedschelders G, Robben J, Van Campenhout S,
Volckaert G & Delcour JA (2003) Molecular identifica-
tion of wheat endoxylanase inhibitor TAXI-I, member
of a new class of plant proteins. FEBS Lett 540, 259–
263.
20 Elliott GO, Hughes RK, Juge N, Kroon PA & William-
son G (2002) Functional identification of the cDNA
coding for a wheat endo-1,4-b-d-xylanase inhibitor.
FEBS Lett 519, 66–70.
21 Flatman R, McLauchlan WR, Juge N, Furniss C,
Berrin J-G, Hughes RK, Manzanares P, Ladbury JE,
O’Brien R & Williamson G (2002) Interactions defining
the specificity between fungal xylanases and the xyla-
nase-inhibiting protein XIP-I from wheat. Biochem J
365, 773–781.
22 Furniss CSM, Belshaw NJ, Alcocer MJC, Williamson
G, Elliott GO, Gebruers K, Haigh NP, Fish NM &
Kroon PA (2002) A family 11 xylanase from Penicillium
funiculosum is strongly inhibited by three wheat xylanase
inhibitors. Biochim Biophys Acta 1598, 24–29.
23 Brutus A, Villard C, Durand A, Tahir T, Furniss C,
Puigserver A, Juge N & Giardina T (2004) The inhibi-
tion specificity of recombinant Penicillium funiculosum
xylanase B towards wheat proteinaceous inhibitors.
Biochim Biophys Acta 1701, 121–128.
K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition
FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5881

Không có nhận xét nào:

Đăng nhận xét